SL9806

Transcript

1 The EMBO Journal Vol.17 No.13 pp.3747–3757, 1998 The snoRNA box C/D motif directs nucleolar targeting and also couples snoRNA synthesis and localization 1,2 1,3 which is required for RNA maturation; and (ii) targeting , Maurille J.Fournier Dmitry A.Samarsky , 3,4 4,5 of mature RNA to its site of function. and Edouard Bertrand Robert H.Singer During the maturation of mRNA, precursors are retained 1 Department of Biochemistry and Molecular Biology, University of near their site of synthesis (Singer and Green, 1997, and 4 Departments of Anatomy Massachusetts, Amherst, MA 01003 and references therein). Subsequently, signals provided by the and Structural Biology and Cell Biology, Albert Einstein College of mature RNA direct it to the cytoplasm (Izaurralde and Medicine, Bronx, NY 10461, USA Mattaj, 1995, and references therein). These two basic 2 Present address: Program in Molecular Medicine, University of processes have been shown to be coupled as, in some Massachusetts Medical Center, Worcester, MA 01605, USA 5 cases, efficient targeting (e.g. nuclear export) requires Present address: Laboratoire de Jean-Marie Blanchard, Institut de end formation) 9 prior processing of the RNA (e.g. 3 Genetique Moleculaire de Montpelier (CNRS), B.P. 5051, 1919 Route de Mende, 34033 Montpelier Cedex 01, France (Eckner et al ., 1991; Huang and Carmichael, 1996). This 3 coupling is manifested spatially at the cellular level by Corresponding authors e-mail: [email protected] or [email protected] localization of the precursor only at the transcription site (Zhang ., 1994). et al Most small nucleolar RNAs (snoRNAs) fall into two Less is known about RNAs which are retained and families, known as the box C/D and box H/ACA targeted within the nucleus. The snoRNAs are a good snoRNAs. The various box elements are essential for example of RNAs which traffic intranuclearly. SnoRNAs exist in the cell in the form of RNP complexes (snoRNPs), snoRNA production and for snoRNA-directed modi- and have been discovered in protozoan, fungal, plant and fication of rRNA nucleotides. In the case of the box mammalian cells (reviewed in Gerbi, 1995; Maxwell and C/D snoRNAs, boxes C and D and an adjoining stem Fournier, 1995; Smith and Steitz, 1997; Tollervey and form a vital structure, known as the box C/D motif. Kiss, 1997). Nearly all have been firmly tied to maturation Here, we examined expression of natural and artificial of rRNA, specifically cleavage of pre-rRNA and synthesis box C/D snoRNAs in yeast and mammalian cells, to of modified nucleotides (see also Maden, 1996; Peculis assess the role of the box C/D motif in snoRNA and Mount, 1996; Bachellerie and Cavaille, 1997). Based localization. The results demonstrate that the motif is on conserved structural features, snoRNAs are now classi- necessary and sufficient for nucleolar targeting, both et al ., ., 1996; Ganot et al fied into three subsets (Balakin in yeast and mammals. Moreover, in mammalian cells, 1997; reviewed in Smith and Steitz, 1997; Tollervey and RNA is targeted to coiled bodies as well. Thus, the box Kiss, 1997). Two of the subsets define large families C/D motif is the first intranuclear RNA trafficking known as the box C/D and box H/ACA families. These signal identified for an RNA family. Remarkably, it families account for all but one snoRNA; the exception also couples snoRNA localization with synthesis and, is the snoRNA known as MRP (Maxwell and Fournier, most likely, function. The distribution of snoRNA 1995; Tollervey and Kiss, 1997) precursors in mammalian cells suggests that this coup- Members of the box C/D snoRNA family, which are ling is provided by a specific protein(s) which binds the subject of the present report, possess characteristic the box C/D motif during or rapidly after snoRNA sequence elements known as box C (UGAUGA) and box transcription. The conserved nature of the box C/D D (GUCUGA). Most box C/D snoRNAs contain long motif indicates that its role in coupling production and ( . 12 nucleotides) sequences complementary to rRNA, localization of snoRNAs is of ancient evolutionary 9 elements, which, in conjunction with adjoining box D or D origin. target rRNA nucleotides to be ribose methylated (reviewed Keywords : box C/D snoRNAs/nucleolus/RNA in Bachellerie and Cavaille, 1997; Smith and Steitz, 1997; localization/snoRNA biogenesis ., 1996; Tollervey and Kiss, 1997; see also Cavaille et al Kiss-Laszlo ., 1996; Tycowski et al ., 1996; Nicoloso et al ., 1996). A few box C/D snoRNAs are required for et al cleavage of pre-rRNA, and this essential function does Introduction not appear to be related to methylation. Biogenesis of eukaryotic RNAs involves maturation of The coding sequences for the box C/D snoRNAs can primary transcripts and targeting of product RNAs to be found in pre-mRNA introns or in mono- or polycistronic sites where they function. Clearly, these two fundamental snoRNA genes. Thus, in the early stages, transcription processes are coordinated in the cell, since precursor and processing of individual snoRNAs differ according to RNAs are usually found at the sites of synthesis, while the nature of the coding unit and, hence, the primary only mature RNAs accumulate at the sites of function. transcript. However, the final maturation steps in each This situation is believed to result from two consecutive case are believed to be similar, and involve exonucleolytic trimming of unprotected RNA ends (reviewed in Tollervey events: (i) initial assembly of a macromolecular complex © Oxford University Press 3747

2 D.A.Samarsky . et al and Kiss, 1997). When the snoRNA possesses a 5 cap, 9 9 this structure protects the 5 end from degradation. In all cases, the box C and D elements function in both RNA stabilization and maturation. In various organisms, mutations in these elements affect snoRNA accumulation et al et al ., 1992; Peculis and (Baserga ., 1992; Huang Steitz, 1994; Terns et al ., 1995; Caffarelli et al ., 1996; ., 1996; et al Cavaille and Bachellerie, 1996; Watkins et al ., 1997; Samarsky and et al Mereau ., 1997; Xia Fournier, 1998). Boxes C and D are usually flanked with inverted repeats, and the base pairing of these segments is also required for RNA accumulation. On this basis, the two boxes and the neighboring helix have been proposed to define a vital structure called the box C/D motif. This motif is believed to be a recognition signal for one or more proteins, which provide metabolic stability of RNA and define the end points in its processing (see also Tyc and Steitz, 1989; Ganot et al ., 1997). Evidence that the putative box C/D motif-binding protein(s) is common and conserved comes from studies showing that: (i) injection Xenopus oocytes inhibits of a box C/D snoRNA into ., accumulation of other box C/D snoRNAs (Terns et al ., 1996); and (ii) box C/D snoRNAs et al 1995; Watkins from distantly related organisms are stabilized and pro- cessed in yeast and animal cells (Li and Fournier, 1992; D.R.Newman, J.C.Liu, M.J.Fournier and E.S.Maxwell, unpublished data). Another, more mysterious aspect of box C/D snoRNA biogenesis is the process by which these RNAs are localized within the nucleus. The snoRNAs are highly enriched in the nucleolus, as the name implies; however, : structure and genomic Fig. 1. The U14 snoRNA from S.cerevisiae the mechanism and signals responsible for this precise organization. U14 is a phylogenetically conserved box C/D snoRNA localization are unknown. This situation reflects our gen- A ) The required for production and maturation of 18S rRNA. ( secondary structure of yeast U14 (adapted from Balakin et al ., 1994; eral lack of knowledge about intranuclear RNA trafficking. ., 1996) is based on results of in vitro et al in vivo Samarsky probing, Indeed, although most eukaryotic RNAs travel through mutagenesis and phylogenetic sequence analyses. Domains A and B the nucleus, very few examples of intranuclear RNA interact with pre-rRNA through complementary base pairing. Domain ., 1995, targeting have yet been analyzed (Jacobson et al A is required for rRNA processing; domain B and the adjoining box D 9 - O -methylation of 18S rRNA. The define a guide motif for 2 1997). Y-domain structure (stem–loop) is conserved in yeast and plants, but The investigation described here was undertaken to gain not animals. It is essential for U14 function. Conserved boxes C and D new insight into the principles of box C/D snoRNA and a terminal stem have been postulated to comprise a recognition biogenesis. Specifically, we wished to define snoRNA motif for a hypothetical protein(s), which upon binding protects the elements sufficient for nucleolar targeting, and to assess RNA from exonucleolytic degradation (highlighted with black). ( U14 is encoded ~70 bp downstream of another S.cerevisiae ) The B the potential inter-relationship between the processes of box C/D snoRNA, snR190. Transcription from a promoter located snoRNA localization and production. Experiments were upstream of snR190 yields a transcript containing both snoRNAs. conducted in both yeast and mammalian cells, using a Mature snR190 and U14 molecules are produced by endonucleolytic natural yeast snoRNA and a variety of artificial variants. cleavages followed by exonucleolytic trimming. Results et al ., 1997; ., 1996; Dichtl et al et al ., 1997; Leader , U14 is encoded Petfalski et al ., 1998). In S.cerevisiae Our study was initiated by analyzing the biogenesis ~70 bp downstream of another box C/D snoRNA, snR190. of the U14 box C/D snoRNA (Figure 1) in the yeast Both snoRNAs are co-transcribed, and the mature molec- . U14 is essential for processing Saccharomyces cerevisiae ules are derived by endonucleolytic cleavage of the dimeric et al ., 1990; Liang of 18S rRNA (Zagorski et al ., 1988; Li precursor, followed by exonucleolytic trimming (Petfalski and Fournier, 1995), and is involved in methylation of ., 1998). The conserved nature of U14 and the fact et al rRNA (Kiss-Laszlo et al ., 1996; Dunbar and Baserga, that it is produced from different types of precursors make 1998). Homologs of U14 have been identified in . 20 this snoRNA particularly attractive for defining the general organisms, including fungi, plants and animals (see the principles involved in biogenesis of box C/D snoRNAs. electronic database by Zwieb, 1997). The U14 coding sequence is found in various genomic arrangements in The box C/D motif provides metabolic stability different eukaryotes, including mono- and polycistronic transcription units and within introns of protein genes and nucleolar localization of snoRNA in yeast Previous mutagenesis studies of yeast U14 yielded stable (Zagorski ., 1988; Liu and Maxwell, 1990; Leverette et al variants for an assortment of deletions and substitutions ., 1995; Samarsky et al ., 1992; Leader et al ., 1994; Xia et al 3748

3 Biogenesis of box C/D snoRNAs ) The coding sequence between boxes C and D was substituted with non-natural sequences of A Expression of modified U14 genes in yeast. ( Fig. 2. different length and structure, to yield plasmids pRA1–pRA4. Plasmids with C* and D* designations contain mutations in boxes C and D known to B ) Production of artificial U14 derivatives was assessed by Northern blot analysis of total RNA, with equal abolish accumulation of natural U14. ( amounts of RNA loaded in each lane. The radiolabeled oligonucleotide probe (SD18) specific for a sequence preceding box D was common to all of the artificial RNAs. The 5.8S, 5S and tRNA species are 158, 120 and 76–87 nucleotides, respectively. The major RNA species identified by hybridization are shown as black wavy lines on the maps of the individual genes. cells harboring a plasmid that does not encode any snoRNA that collectively spanned nearly all of the region between boxes C and D (Jarmolowski ., 1990). These results et al (data not shown). These results indicate that the box C/D motif is sufficient to localize RNA to the nucleolus in indicate that the internal segment does not contain informa- tion required for snoRNA production. However, in no case yeast cells. was the effect of a clean internal deletion or substitution examined. To resolve this issue, we created four gene The box C/D motif directs snoRNA production and constructs in which artificial sequences replaced the 104 nucleolar localization in mammalian cells bp segment that normally lies between the box elements We next asked if the cis -acting determinants shown to be (pRA1–pRA4; Figure 2A). The artificial segments were sufficient for box C/D RNA accumulation and nucleolar 47, 54, 120 and 228 bp in length. After expression in localization in yeast play similar roles in mammalian cells. yeast, each new gene produced a single stable RNA of To this end, we analyzed expression of yeast U14 and the expected size, corresponding to the artificial portion, one of the artificial box C/D RNAs in monkey cells. The boxes C and D and a terminal stem (~69, 76, 142 and artificial RNA contained a 120 nucleotide non-natural 250 nucleotides; Figure 2B, see also Figure 1A). The sequence between boxes C and D (from pRA3; see artificial RNAs accumulated at levels similar to that of Figure 2). The RNAs were expressed in monkey COS-1 natural U14 expressed in the same genetic context (control cells, from the human U6 snRNA gene promoter. The U6 data are not shown). Double point mutations in either box promoter utilizes RNA polymerase III but, in contrast to C or box D, known to abolish yeast U14 production conventional Pol III promoters, is located upstream of the (Huang ., 1992), blocked accumulation of the artificial et al transcribed region, rather than within. Thus, little constraint RNAs as well (constructs C* and D*; Figure 2). These is placed on the sequence of the transcript. An added results demonstrate that the RNA region between boxes advantage of this promoter is that transcripts are not C and D does not contain information required for accumu- capped, which eliminates potential complications associ- lation and processing, and that the box C/D motif is ated with a 5 cap structure. 9 necessary and sufficient for the stability of the artificial The genes to be tested were cloned into the mammalian box C/D RNAs. et al ., 1997) to yield 1 pU6 1 expression vector (Bertrand To assess whether the determinants directing snoRNA constructs pU6Y (yeast U14) and pU6A (artificial RNA; accumulation are also involved in intracellular targeting, Figure 4A). Each new gene contained yeast DNA that we examined the localization of an artificial box C/D normally occurs up- and downstream of the coding hybridization microscopy in situ RNA using fluorescent sequence for mature yeast U14, ~30 bp on the 5 9 side and (Figure 3). The nucleoli, which in yeast form so-called side. Precursor RNAs derived from ~130 bp on the 3 9 ‘crescent bodies’, were visualized with a probe specific these constructs were predicted to be ~225 (yeast U14) for natural U14. Strikingly, the same pattern was obtained and ~250 nucleotides (artificial RNA), based on the with a probe specific for the artificial RNA, and double assumption that a stretch of seven T nucleotides, located hybridization showed that both RNAs co-localize. The 72 bp downstream of the box D, serves as a termination specificity of the signals was verified by hybridization of signal for RNA polymerase III. To avoid the possibility 3749

4 D.A.Samarsky et al . Fig. 3. The artificial box C/D RNA localizes in the nucleolus of yeast cells. Yeast cells expressing the artificial RNA from plasmid pRA3 were probed simultaneously for natural yeast U14 (red) and the artificial box C/D RNA (green). The two signals are superimposable, yielding a yellow μ m. DNA was additionally stained with DAPI (blue). color on the overlap. Scale bar is 2 Fig. 4. ) The potential to produce yeast U14 and one of the artificial box C/D Expression of experimental box C/D RNAs in mammalian cells. ( A RNAs was evaluated by fusing the corresponding gene sequences to a human U6 snRNA gene promoter and introducing the resulting constructs (pU6Y and pU6A) into monkey COS-1 cells by transient transfection. The fused segments were derived from the wild-type U14 gene and pRA3 9 side and ~130 bp on the 3 9 side of the non-coding regions up- and downstream of the box C and plasmid (Figure 2), and included ~30 bp on the 5 D elements. The cross-hatched boxes correspond to the U6 gene promoter. The poly(T) stretches designate putative Pol III termination sites located 72 bp downstream of box D. The wavy lines represent the RNA species identified by hybridization. ( ) Patterns of RNA production. The blots were B prepared from total RNA isolated from monkey (M) and yeast (Y) cells expressing yeast U14 and/or the artificial RNA. Equal amounts of total RNA from each cell type were fractionated in neighboring lanes of the same gel. The resulting blot was cut into two halves, which were subjected to Northern hybridization with probes specific to either yeast U14 (C106) or the artificial RNA (SD121). The blot was reconstructed prior to radioautography. using fluorescent in situ of premature transcription termination of the artificial hybridization analysis. A hybrid- ization probe recognizing monkey U14 snoRNA was used RNA gene, a run of four T residues immediately upstream to visualize the nucleolus. Both, yeast U14 and the artificial of box D was modified by deleting two T nucleotides. RNAs localized to the nucleoli (Figure 5A; data are shown The new genes were introduced into monkey cells by transient transfection. Stable RNAs accumulated in each for the artificial RNA). Expression of control RNAs case, and the major products were the same size as the lacking boxes C and D, or possessing only box C, yielded patterns of uniform distribution over the entire corresponding RNAs produced in yeast (~130 nucleotides nucleoplasm (not shown). This last result verified that the for yeast U14 and ~155 nucleotides for artificial RNA; nucleolar localization of yeast U14 and the artificial RNAs Figure 4B). Minor bands corresponding in size to the precursor molecules expected were observed after longer is specific and depends on the presence of a box C/D motif. Interestingly, a higher resolution analysis revealed exposure of the Northern blot (data not shown). These results show that the box C/D motif is sufficient for that the artificial RNA localizes in a sub-nucleolar compart- ment(s), which shows partial, but not complete overlap accumulation of box C/D RNAs in phylogenetically distant mammalian cells, as well as in yeast. with natural monkey U14 or the nucleolar protein fibrillarin Intracellular localization of yeast U14 and the artificial (Figure 5B; data for fibrillarin are not shown). This pattern box C/D RNAs was then examined in the monkey cells, suggests that localization of snoRNAs within the nucleolus 3750

5 Biogenesis of box C/D snoRNAs Fig. 5. Localization of artificial box C/D RNA in mammalian cells. The intranuclear location of the artificial box C/D snoRNA in monkey COS-1 in situ A μ m. The DNA was stained additionally with DAPI (blue). ( cells was analyzed by fluorescent ) The hybridization. The scale bar is 2 artificial box C/D RNA localizes in the nucleoli. Cells transiently expressing the artificial RNA were probed simultaneously for natural monkey U14 (red) and the artificial box C/D RNA (green). The two signals are superimposable, as shown by the overlap. ( B ) High resolution analysis of the distribution of the artificial snoRNA within the nucleolus. Cells transiently expressing the artificial box C/D RNA were probed simultaneously for natural monkey U14 (red) and the artificial RNA (green). The two signals are partially superimposable, as shown by the overlap. ( C ) The artificial box C/D RNA localizes in coiled bodies of mammalian cells. Cells transiently expressing the artificial box C/D RNA were processed for in situ hybridization against the artificial RNA (red). The overlap shows that the artificial RNA immunodetection of coilin (green) and for accumulates in all the coiled bodies. is influenced by RNA structural elements in addition to nucleoplasm (see Figure 5A). These dots could correspond the terminal box C/D motif. to RNA transcription sites (see below), but also to coiled The distribution patterns of the experimental RNAs also bodies, since at least one box C/D snoRNA, U3, has been showed the presence of sharp, dot-like signals in the found in coiled bodies of mammalian and plant cells (see 3751

6 D.A.Samarsky et al . ., et al nucleolus. Interestingly, in mammalian cells, the box ., 1994; Raska, 1995; Olmedilla Jimenez-Garcia et al 1997). The latter suggestion was examined by double in C/D motif also targets RNAs to the coiled bodies. hybridization with probes for the test RNAs and situ antibodies against coilin, a specific protein component of Processing of experimental box C/D RNAs occurs coiled bodies (Figure 5C; data are shown for the artificial in the nucleoplasm of mammalian cells RNA). The results showed that, indeed, yeast U14 and To determine the sites of box C/D snoRNA processing in the artificial RNAs accumulate in coiled bodies as well the mammalian nucleus, we performed a localization as in the nucleolus. analysis of RNA precursors, once again using yeast U14 To determine where transcription of the test snoRNAs and the artificial RNA featured earlier. The precursor occurs in the nucleus, we performed an in situ hybridization probe selected hybridizes specifically to a sequence down- analysis of transfected monkey cells with: (i) a probe stream of box D (see Materials and methods). This probe specific for a non-transcribed sequence of the plasmid; was used in conjunction with the probes used previously and (ii) probes used previously which recognize the mature for the mature RNAs and the corresponding plasmid DNA. artificial and yeast U14 snoRNA molecules, respectively. In situ hybridization analyses showed that precursors The plasmid probe yielded sharp dots in the nucleoplasm in several places. Differences in signal intensity in the various dots are presumed to reflect differences in gene copy number at the respective sites. Although the plasmid could sometimes be found at the edge of the nucleolus, it was always excluded from this region (data for yeast U14 are shown in Figure 6A, upper panel). Double labeling with coilin antibodies did not reveal co-localization of plasmids with coiled bodies (not shown). Most of the plasmid sites are transcriptionally active, as revealed by double hybridization with the plasmid and mature RNA probes (Figure 6A, upper panel). These results indicate that yeast U14 and the artificial RNAs are initially produced in the nucleoplasm and targeted to the nucleolus post- transcriptionally. Taken together, these results demonstrate that, as in yeast, the box C/D motif is sufficient for RNA accumula- tion and nucleolar localization in mammalian cells. Thus, in mammals, and presumably in yeast, snoRNAs are transcribed in the nucleoplasm and then transported to the Fig. 6. Transcription and processing sites of the artificial box C/D RNAs in mammalian cells. COS-1 cells transiently transfected with a in situ plasmid expressing yeast U14 were hybridized with various combinations of probes specific for mature RNA, precursor RNA or the transfected plasmid (see Materials and methods). ( ) Only mature A RNA is present in the nucleolus. Cells were transfected with a non- replicative plasmid. The top panel shows a cell hybridized with the plasmid probe (red) and with the mature RNA probe (green). The overlap shows that the plasmid is excluded from the nucleolus, and represents a bona fide transcription site since it co-localizes with the RNA. The middle panel shows a cell hybridized with the precursor probe (green), and with a probe for monkey U3, which is a nucleolar box C/D snoRNA (red). The overlap shows that the precursor is absent in the nucleolus. The bottom panel shows a cell hybridized with the plasmid probe (red) and with the precursor probe (green). The overlap shows that the precursor is associated predominantly with the ) Overexpression yields only plasmid, i.e. at its transcription site. ( B mature RNA throughout the nucleoplasm and in the nucleolus. Cells were transfected with a replicative plasmid. The nucleolus was visualized with DAPI staining (blue), and is marked with arrows. The top panel shows a cell hybridized with a probe for the mature RNA (green) and with the plasmid probe (red). The plasmid is excluded from the nucleolus (arrows) and forms a speckled pattern, while the mature RNA is present in the nucleolus (arrows), at the transcription sites, and also at a low level throughout the entire nucleoplasm. The middle panel shows a cell hybridized with the plasmid probe (red) and with the precursor probe (green). Both plasmid and precursor RNA are excluded from the nucleolus and form a speckled pattern (arrows). The bottom panel shows a cell hybridized with a probe for the mature RNA (red) and for the precursor (green). The precursor is excluded from the nucleolus (arrows) and forms a speckled pattern, while the mature RNA is found in the nucleolus (arrows), and also at a lower level through the entire nucleoplasm. 3752

7 Biogenesis of box C/D snoRNAs localized to distinct areas outside the nucleolus (Figure 6A, motif. Since the box C/D motif defines one of the two central panel; results are shown for yeast U14 only, but major snoRNA families, we predict that it is used as a are identical for the artificial snoRNA). Double in situ nucleolar localization signal for all box C/D snoRNAs, i.e. for scores of RNA species in various eukaryotes. In hybridizations with the precursor and plasmid probes 7 G cap and the poly(A) showed that the precursors localized predominantly to the this regard, it is similar to the m tail or the Sm-binding site, which define whole classes of same regions as the transfected plasmids (Figure 6A, RNAs and also function as determinants of RNA localiz- lower panel). ation (see Hamm et al ., 1990; Marshallsay and Luhrmann, Detection of RNA precursors at the putative transcrip- 1994; Huang and Carmichael, 1996; Lewis and Izaurralde, tion sites suggests that processing of immature RNAs 1997). It is tempting to speculate that the unknown takes place in the nucleoplasm, immediately after tran- localization signals in other RNA families might also be scription. It is possible, though less likely, that maturation shared by all family members. If true, this common occurs in the nucleolus after targeting. In this case, property could greatly facilitate identification of such processing would have to occur so rapidly that precursors signals in the future. Thus, it is reasonable to expect that cannot be detected by our assay. An attempt to resolve these the conserved box elements which define the H/ACA two alternatives was made by analyzing the distribution snoRNA family also function in RNA targeting, as well patterns of non-processed and processed RNAs in monkey as in RNA production. cells transfected with replicative plasmids. These vectors In mammalian cells, the artificial RNAs were also occur at a higher copy number and were expected to yield detected in the coiled bodies. This last finding is consistent higher levels of precursors. We reasoned that this strategy with earlier observations of U3 box C/D snoRNAs in the could allow unprocessed RNAs to be detected at other coiled bodies of animal (human HeLa) and plant (olive) nuclear locations. ., 1994; Raska, 1995; Olmedilla cells (Jimenez-Garcia et al Overproduction of RNAs was achieved when the box et al ., 1997), and reinforces striking similarities between C/D RNA genes were expressed from the replicative the coiled bodies and the nucleolus. Indeed, in addition plasmids pU6Yrep and pU6Arep (Figure 6B; results are to snoRNAs, both compartments contain common proteins, shown for yeast U14, but are identical for the artificial including fibrillarin, Nopp140, Nap57 and Sp6 (reviewed In situ RNA). hybridization demonstrated that despite a in Brasch and Ochs, 1992). In light of the recent discovery much higher expression level, the precursor was still that a box C/D snoRNA guides methylation of a splicing detected only at the transcription sites. Interestingly, in snRNA (K.T.Tycowski, Z.-H.You, P.Graham and J.A. cells expressing the highest levels of experimental RNAs, Steitz, personal communication), and the fact that coiled signals were distributed over the entire nucleoplasm, in bodies also contain splicing snRNAs (see Brasch and addition to the nucleolus. This last result most likely Ochs, 1992; Carmo-Fonseca ., 1992; Matera and et al reflects saturation of box C/D RNA uptake and/or retention Ward, 1993; Gall ., 1995), our results raise the et al sites in the nucleolus, leading to nucleoplasmic accumula- fascinating possibility that methylation of splicing snRNAs tion of RNAs. This view is supported by our observation occurs in coiled bodies. that natural monkey U14 snoRNA also accumulates in Detection of the box C/D RNA precursors at the the nucleoplasm of cells overproducing the experimental transcription sites, but never in the nucleolus, suggests box C/D RNAs (data not shown). Parallel hybridizations that processing occurs at or near the sites of transcription, with precursor- and plasmid-specific probes showed that and the RNAs are targeted to the nucleolus as mature- in overexpressing cells, the precursor RNAs localize at length molecules. When expressed at high levels, pro- the transcription sites, which form a characteristic speckled cessed RNAs accumulated throughout the entire nucleus, pattern, and that the remaining population of RNAs in the indicating saturation of nucleolar uptake/retention sites. nucleoplasm represents processed RNAs (Figure 6B). Importantly, in these cells, the precursor RNAs were still Taken together, these results argue that in mammalian confined to the transcription sites, suggesting that precursor cells, precursors to the box C/D snoRNAs are produced processing was not a limiting factor, and that processing in the nucleoplasm, processed at or near the sites of occurs in the nucleoplasm during, or soon after tran- transcription and only then are localized to the nucleolus. scription. Discussion A general model of box C/D snoRNA biogenesis Both RNA maturation and nucleolar targeting appear to The expression and localization results provide new insights into the biogenesis of the box C/D snoRNAs in be mediated by the same RNA structure, the box C/D -acting box cis eukaryotic cells. In particular, the simple motif. Because it seems certain that this motif is a protein recognition signal, and because of its small size, it seems C/D motif was shown to direct intranuclear trafficking of likely that: (i) these functions are mediated by the same box C/D snoRNAs, from the nucleoplasmic sites of synthesis to the nucleolus. The new results also argue protein or a small set of core proteins and (ii) both motif- strongly that production and intracellular targeting of the dependent processes require formation of the same initial box C/D snoRNAs are tightly coupled. complex. Accordingly, the major principles of box C/D snoRNA Principles of intranuclear localization of box C/D synthesis can be summarized in a simple model (Figure 7). Regardless of the nature of the primary transcript and its snoRNAs The localization results obtained with the artificial box initial processing events, it will fold in such a way that C/D snoRNAs showed that, both in yeast and mammalian boxes C and D are brought together to form the box C/D cells, nucleolar targeting is mediated by the the box C/D motif. The motif is then rapidly recognized and bound by a 3753

8 D.A.Samarsky . et al Fig. 7. General model for box C/D snoRNA biogenesis in eukaryotic cells. The model proposed is based on expression results obtained here and earlier with various box C/D snoRNAs in different cells and in different genetic contexts. The major features are predicted to be universal for all box C/D snoRNAs. Variations are likely to occur in the early steps, due to differences in genomic arrangements, i.e. introns of protein genes, or mono- or polycistronic snoRNA transcription units. Transcription occurs in the nucleoplasm. Folding of the precursor produces a functional box C/D motif. This motif is then recognized by a box C/D snoRNA family-specific binding protein(s). These events occur during (as depicted), or rapidly after transcription. A transcript then follows one of two possible pathways: (i) a precursor capped with monomethylguanosine (open circle) is end by exonucleases, or (ii) if uncapped, the precursor is trimmed 9 hypermethylated to yield trimethylguanosine (closed circle) and trimmed at the 3 at both ends. In both cases, protein binding via the box C/D motif is then responsible for the delivery of the snoRNA to the nucleolus. motif, i.e. that TMG synthesis is activated shortly after nucleoplasmic protein which alone, or with other proteins, transcription by the same motif-specific protein(s). protects the snoRNA from degradation by exonucleases It seems certain that direct binding of a motif-specific that specify the ends of the mature molecule. This initial protein(s) and conversion of naked RNA to a core snoRNP RNP complex alone, or in conjunction with additional complex is a pivotal step in both production and localiz- nucleoplasmic factors, is then delivered to the nucleolus. ation of the box C/D snoRNAs. This arrangement provides Translocation could occur by active transport or by simple a reliable and efficient means of integrating these two diffusion and subsequent nucleolar binding through com- major aspects of snoRNA biogenesis, since common mon protein components. factors are required for both processes and render them Maturation of box C/D snoRNAs can also include: (i) inseparable. Such coupling might be common for other modification of internal nucleotides, about which little is classes of eukaryotic RNA as well. For example, both ., 1983; known (see Reddy et al ., 1979; Wise et al processing and nuclear export of mRNAs are believed to Reddy and Busch, 1988); and (ii) formation of a 5 9 be affected by some hnRNP proteins and components of trimethylguanosine (TMG) cap. TMG cap formation is 7 the nuclear cap-binding complex (reviewed in Weighardt G believed to result from hypermethylation of the m ., 1996; Lewis and Izaurralde, 1997). et al cap normally found in RNA polymerase II transcripts. In addition to integrating the various aspects of snoRNA Interestingly, hypermethylation of the U3 and Xenopus synthesis (maturation, stability and localization), there is U8 caps occurs in the nucleoplasm, and has been shown the intriguing possibility that the box C/D motif also to depend on box D and the adjoining terminal stem links snoRNA synthesis with function. In particular, this ., 1995). This last finding raises the possibility (Terns et al possibility applies to the snoRNAs which guide methyl- that hypermethylation also depends on the box C/D 3754

9 Biogenesis of box C/D snoRNAs derivatives containing mutant box C (box C*) or box D (box D*) ation of rRNA. The guide function is mediated by a long elements. sequence complementary to the rRNA segment to be Plasmid pU6Y and pU6A were obtained by cloning into the pU6 1 1 modified, and site selection depends on a box D or D-like vector (Bertrand ., 1997) the PCR products obtained from plasmids et al ) located immediately downstream 9 element (CUGA, box D pCer and pRA3 with the oligonucleotides SD24 and SD81 (GTGGGTAATTTGAGTTAACAGATAATATAT). Plasmids pU6Yrep of the guide sequence. Methylation occurs in the comple- and pU6Arep were obtained by cloning the SV40 origin of replication mentary rRNA sequence, precisely five nucleotides from into the pU6Y and pU6A plasmids. Detailed restriction maps are . Some guide sequences occur near the 3 end, 9 9 box D/D available upon request. immediately upstream of the canonical box D, whereas others occur in the interior of the RNA adjoined to box RNA preparation and Northern blot analysis Total RNA from yeast cells was isolated using an acidic phenol/glass D 9 . Some snoRNAs contain guide sequences in both bead procedure (Kohrer and Domdey, 1991). RNA from mammalian arrangements. Interestingly, we and others noted that ., cells was prepared using the guanidine-HCl method (Sambrook et al 9 snoRNAs with internal guide sequences and box D also 1989). Northern analysis was performed as described previously (Balakin contain an additional box C-like sequence (UGAU) at a ., 1995). Oligonucleotide probes used for et al ., 1993; Samarsky et al hybridization were C106 (CGATGGGTTCGTAAGCGTACTCCTACC- , suggesting that 9 modest distance downstream of box D GTGG), specific for yeast U14 snoRNA, and SD18 (see above), specific these RNAs have a second box C/D motif, in addition to for all artificial RNAs, except RNA expressed in mammalian cells. et al the canonical one (Kiss-Laszlo ., 1998; D.A.Samarsky, Oligonucleotide (GCGTAATACGACTCACTATAGGGCG- SD121 unpublished). Results from recent mutational studies have AATTGGCC) was used to probe artificial RNA expressed in mamma- demonstrated that the novel box C-like element (called lian cells. ) is essential for the methylation reaction, but not 9 box C In situ hybridization et al for snoRNA accumulation (Kiss-Laszlo ., 1998). This Mammalian cells were fixed for 10 min at room temperature in 4% finding argues that one or more proteins involved in the formaldehyde, 10% acetic acid, phosphate-buffered saline (PBS; 100 mM methylation function also bind directly or indirectly to the , 137 mM NaCl, 27 mM KCl, pH 7.4). After HPO PO ,20mMKH Na 2 4 2 4 two washes in PBS, cells were permeabilized by treatment with 70% simple box C/D motif, and that snoRNA production and 3 ethanol for at least overnight. After rehydration in 2 SSC (300 mM function may be connected at this level. It will be NaCl, 30 mM sodium citrate, pH 7.0), 50% formamide, cells were interesting to learn if the motif-binding protein(s) includes hybridized overnight at 37°C in 40 μ l of a mixture containing 10% a ribose methylase enzyme. dextran sulfate, 2 mM vanadyl-ribonucleoside complex, 0.02% RNase- SSC, 50% free bovine seum albumin (BSA), 40 μ gof E.coli tRNA, 2 3 The strict conservation of the box C/D motif among formamide, 30 ng of probe. Cells were then washed twice for 30 min different snoRNAs in evolutionarily divergent eukaryotes at the appropriate stringency (2 SSC, 50% formamide, 37°C for 3 indicates that the principles of box C/D snoRNA biogen- SSC, 50% formamide, 50°C for RNA 3 oligonucleotide probes; 0.1 esis, in particular synthesis and intranuclear targeting, are probes). When required, slides were then processed for immunofluores- universal to all RNAs in this family and, hence, are as cence. Digoxigenin-labeled probes were detected with sheep anti-digoxi- genin antibodies (1/200, Boehringer Mannheim), and then with donkey ancient as the eukaryotic world itself. anti-sheep antibodies conjugated to fluorescein (1/150, Sigma). Slides SSC, 8% formamide, 2 mM were incubated for 1 h at 37°C in 2 3 vanadyl-ribonucleoside complex, 0.2% RNase-free BSA, and washed Materials and methods SSC, 8% formamide at room temperature. 3 twice for 15 min in 2 Yeast cells were prepared for in situ hybridization as previously Yeast strains and mammalian cell lines S.cerevisiae haploid All yeast experiments were carried out with the et al described (Long ., 1995), except that cells were fixed for 10 min at ). This strain was prepared by sporulating ura3-167 strain YSD92 ( room temperature by addition of 10 ml of 2% formaldehyde, 5% acetic α / a strain YS152 ( /HIS3 his4-280/HIS4 trp1/TRP1 ura3-167/URA3 ∆ his3 acid, to 45 ml of culture medium. Hybridization was performed as for GAL1::U14:HIS3/U14 ) described previously as a diploid obtained after mammalian cells. et al ., 1990). mating of haploid strains YS133 and E280 (Jarmolowski -phenylendiam- Slides were mounted in 90% glycerol, PBS, 1 mg/ml p Yeast transformants were grown on YNBD (0.67% yeast nitrogen base, μ ,6-diamidino-2-phenylindole (DAPI). 9 g/ml 4 ine, 0.1 2% glucose) medium at 30°C. COS-1 cells were grown in Dulbecco’s modified Eagle’s medium Image acquisition and processing (DMEM) containing 10% fetal calf serum. Transfections were performed Images were captured using a CellScan system (Scanalytics, Fairfax, ., et al by a DNA–calcium phosphate co-precipitation method (Sambrook VA), with a CH250 CCD camera (Photometrics, Tucson, AZ), mounted g of DNA per 3 cm dish. Cells were fixed 36 h after μ 1989), using 10 on a Provis AX70 epifluorescence microscope (Olympus, Melville, NY). addition of the precipitate. Except for Figure 6B, where only a single plane was recorded, red- and -axis, for a z green-filtered images were captured every 200 nm on the Plasmid construction total of 20–25 images, and were then deconvolved using EPR (exhaustive The artificial snoRNA sequences were derived from Escherichia coli photon reassignment) software (Scanalytics). A single median plane was vector pUC18 and newly created plasmids pBl-B, pBl-KS and pBl-C. recorded for blue-filtered images. Restored three-dimensional images The latter constructs were prepared from the pBluescript IISK(–) E.coli were observed to select one or a few consecutive planes which were vector by deleting a Bss HII restriction fragment (pBl-B), deleting a z projected onto the -axis. The resulting two-dimensional images were Cla I restriction site (pBl-C). Kpn Sac I– I fragment (pBl-KS) or removing a then scaled so that the signal occupies the full dynamic range of light Yeast plasmids pRA1, pRA2, pRA3 and pRA4 were prepared from a intensities, pseudocolored and superimposed. ., 1996). This parental et al previously created plasmid pCer (Samarsky plasmid contains a 1.3 kb Cla genomic DNA fragment S.cerevisiae I Preparation of probes for in situ hybridization The probes used to detect natural monkey snoRNAs were amino- with genes for snR190 and U14 snoRNAs, cloned into a Cla I site of modified DNA oligonucleotides of the following sequences: T*AT- yeast vector pRS316. The pRA1–pRA4 derivatives were made by CCAAGGAAGGT*AGTTGCCAACAT*AAGACTTTCTGGT*GGAA- substituting the DNA between U14 boxes C and D with DNA fragments ACTACGAAT*T for U14 and T*CTTCCTCGTGGTTTT*CGGTG- located between and encompassing the universal primer regions of CTCTACACGT*T for U3 snoRNAs (the amino-modified T nucleotides plasmids pUC18, pBl(-B), pBl(-KS) and pBl(-C), respectively. The are marked with asterisks). These oligonucleotides were synthesized and DNA replacement fragments were prepared by PCR amplification with labeled with Cy3 (U14) or Cy2 (U3; Amersham), as previously described oligonucleotide primers SD15 (ATTTATGATCACGGTGATGAGG- (Kislauskis et al ., 1993). AAACAGCTATGACCAT) and SD18 (CTACAGTATACGATCACTCA- with T7 or T3 RNA in vitro All other probes were RNAs synthesized GACGTAAAACGACGGCCAGTGA). Oligonucleotides SD49 (TATA- polymerase. The DNA templates were: PCR products encompassing the TATAATTTATGATCACGGTCTTGAGG) and SD50 (AAGATACTA- RNA coding sequence for the artificial box C/D RNA and yeast U14 CAGTATACGATCACAGAGACG) were used for making pRA1–pRA4 3755

10 D.A.Samarsky . et al (yielding probes of 130 and 120 nt, respectively); a plasmid containing (1992) Transcription-dependent colocalization of the U1, U2, U4/U6, 9 to box D for the precursor probe the yeast U14 transcribed sequences 3 , 1–14. 117 ., . J. Cell Biol and U5 snRNPs in coiled bodies (linearized to yield an ~130 nucleotide transcript); and pBluescript Cavaille,J. and Bachellerie,J.-P. (1996) Processing of fibrillarin- ) deleted of its polylinker for the plasmid-specific probe (linearized 1 SK( associated snoRNAs from pre-mRNA introns: an exonucleolytic Pvu with II to yield an ~230 nucleotide probe). process exclusively directed by a common stem-box terminal structure. Except for the precursor probe, the RNA probes were labeled with a 78 , Biochimie , 443–456. novel procedure. This protocol was developed to allow for high incorpora- Cavaille,J., Nicoloso,M. and Bachellerie,J.-P. (1996) Targeted ribose tion of the fluorescent label (typically 5–10%, which is 5–10 times directed by tailored antisense RNA in vivo methylation of RNA higher than can be obtained by labeling during transcription), and for , 732–735. 383 , Nature guides. quantitative studies, since it renders the use of antibodies for signal Dichtl,B., Stevens,A. and Tollervey,D. (1997) Lithium toxicity in yeast amplification unnecessary. It was developed as a versatile, low-cost EMBO J is due to the inhibition of RNA processing enzymes. 16 , ., alternative to amino-modified synthetic oligonucleotides (Kislauskis 7184–7195. ., 1993), and was derived from an existing protocol used to label et al Dunbar,D.A. and Baserga,S.J. (1998) The U14 snoRNA is required for ., 1991). Details of the procedure et al RNA for microinjection (Wang - 9 2 , 4 , RNA oocytes. Xenopus -methylation of the pre-18S rRNA in O are available on the web site http://Singerlab.aecom.yu.edu. Briefly, 195–204. RNAs were synthesized using amino-allyl UTP instead of UTP during 9 Eckner,R., Ellmeier,W. and Birnstiel,M.L. (1991) Mature mRNA 3 end transcription. Transcription reactions were phenol extracted, RNA was 10 formation stimulates RNA export from the nucleus. , EMBO J ., SSC, and unincorporated nucleotides precipitated, resuspended in 1 3 3513–3522. were removed by gel filtration (1 3 SSC-buffered P30 micro-spin column, Gall,J.G., Tsvetkov,A., Wu,Z. and Murphy,C. (1995) Is the sphere Bio-Rad). RNA was again ethanol precipitated and resuspended in water. ., organelle/coiled body a universal nuclear component? Dev. Genet μ g of RNA (depending on the Labeling was initiated by mixing 4–50 , 25–35. 16 μ final specific activity desired), resuspended in 70 l of 0.1 M NaHCO Ganot,P., Caizergues-Ferrer,M. and Kiss,T. (1997) The family of box 3 ACA small nucleolar RNAs is defined by an evolutionarily conserved buffer, pH 8.8, with one vial of Cy3, or 1 mg of Oregon green 488 secondary structure and ubiquitous sequence elements essential for l of dimethylsulfoxide (DMSO). μ (Molecular Probes) resuspended in 30 ., , 941–956. RNA accumulation. Genes Dev 11 Labeling was performed for 48 h in the dark, at room temperature, with ., Biochem. Cell. Biol Gerbi,S.A. (1995) Small nucleolar RNA. 73 , occasional vortexing. Unreacted dye was removed by two rounds of 845–858. ethanol precipitation and washing. Specific activity of the probes was Hamm,J., Darzynkiewicz,E., Tahara,S.M. and Mattaj,I.W. (1990) The calculated by absorption spectroscopy. trimethylguanosine cap structure of U1 snRNA is a component of a The probes for the artificial RNA and yeast U14 were labeled with a bipartite nuclear targeting signal. Cell , 62 , 569–577. specific activity 20 times lower than for the plasmid probe. This ensured Huang,G.M., Jarmolowski,A., Struck,J.C.R. and Fournier,M.J. (1992) that these probes detected RNA preferentially and not the plasmid. Saccharomyces cerevisiae Accumulation of U14 small nuclear RNA in Indeed, a labeled plasmid probe of similar specific activity gave signals requires box C, box D, and a 5 ,3 9 terminal stem. Mol. Cell. Biol 9 ., much fainter than the ones detected with the artificial and yeast U14 , 4456–4463. 12 probes (data not shown). The probe for the precursor was labeled with Huang,Y. and Carmichael,G.C. (1996) Role of polyadenylation in digoxigenin-UTP during transcription. This probe detected predominantly , 1534– nucleocytoplasmic transport of mRNA. Mol. Cell. Biol ., 16 RNA, not the plasmid, since an antisense precursor probe failed to give 1542. signals (data not shown). Izaurralde,E. and Mattaj,I.W. (1995) RNA export. Cell , 153–159. 81 , Jacobson,M.R., Cao,L.G., Wang,Y.L. and Pederson,T. (1995) Dynamic localization of RNase MRP RNA in the nucleolus observed by Acknowledgements 131 ., fluorescent RNA cytochemistry in living cells. J. Cell Biol , We thank Thomas Meier for the gift of coilin antibodies and many helpful 1649–1658. in discussions, Pascal Chartrand and Roy Long for help in conducting Jacobson,M.R., Cao,L.G., Taneja,K., Singer,R.H., Wang,Y.L. and situ hybridization in yeast, and Elizabeth Furter-Graves for editorial Pederson,T. (1997) Nuclear domains of the RNA subunit of RNase P. help. Research by D.A.S. and M.J.F. was supported by NIH grant GM J. Cell. Sci ., 110 , 829–837. 19351 and NSF grant MCB-9419007, and that by E.B. and R.H.S. by (1990) Fournier,M.J. and Li,H.V. Zagorski,J., Jarmolowski,A., NIH grants GM54887 and GM 57071. Saccharomyces Identification of essential elements in U14 RNA of cerevisiae . EMBO J , 4503–4509. 9 ., Jimenez-Garcia,L.F., Segura-Valdez,M.L., Ochs,R.L., Rothblum,L.I., Hannan,R. and Spector,D.L. (1994) Nucleologenesis: U3 snRNA- References containing prenucleolar bodies move to sites of active pre-rRNA Bachellerie,J.-P. and Cavaille,J. (1997) Guiding ribose methylation of , 955–966. 5 , Mol. Biol. Cell transcription after mitosis. ., rRNA . Trends Biochem. Sci 22 , 257–261. Kislauskis,E.H., Li,Z., Singer,R.H. and Taneja,K.L. (1993) Isoform- Balakin,A.G., Schneider,G.S., Corbett,M.S., Ni,J. and Fournier,M.J. -untranslated sequences sort alpha-cardiac and beta- 9 specific 3 (1993) SnR31, snR32, and snR33: three novel, non-essential snRNAs cytoplasmic actin messenger RNAs to different cytoplasmic , 5391–5397. 21 ., Nucleic Acids Res . Saccharomyces cerevisiae from compartments. J. Cell Biol , 165–172. ., 123 Balakin,A.G., Lempicki,R.A., Huang,G.M. and Fournier,M.J. (1994) Kiss-Laszlo,Z., Henry,Y., Bachellerie,J.-P., Caizergues-Ferrer,M. and Saccharomyces cerevisiae U14 small nuclear RNA has little secondary Kiss,T. (1996) Site-specific ribose methylation of preribosomal RNA: structure and appears to be produced by post-transcriptional processing. Cell , 85 , 1077–1088. a novel function for small nucleolar RNAs. , 739–746. J. Biol. Chem ., 269 Kiss-Laszlo,Z., Henry,Y. and Kiss,T. (1998) Sequence and structural Balakin,A.G., Smith,L. and Fournier,M.J. (1996) The RNA world of the elements of methylation guide snoRNAs essential for site-specific nucleolus: two major families of small RNAs defined by different box ., 17 , 797–807. ribose methylation of pre-rRNA. EMBO J 86 , 823–834. , Cell elements with related functions. Kohrer,K. and Domdey,H. (1991) Preparation of high molecular weight Baserga,S.J., Gilmore-Hebert,M. and Yang,X.W. (1992) Distinct ., Methods Enzymol 194 RNA. , 398–405. molecular signals for nuclear import of the nucleolar snRNA, U3. Leader,D.J., Sanders,J.F., Waugh,R., Shaw,P. and Brown,J.W.S. (1994) ., , 1120–1130. 6 Genes Dev Molecular characterisation of plant U14 small nucleolar RNA genes: et al . (1997) The expression cassette determines the Bertrand,E. closely linked genes are transcribed as polycistronic U14 transcripts. functional activity of ribozymes in mammalian cells by controlling , 5196–5203. 22 ., Nucleic Acids Res , 75–88. 3 their intracellular localization. RNA , and Leader,D.J., Clark,G.P., Watters,J., Beven,A.F., Shaw,P.J. Brasch,K. and Ochs,R.L. (1992) Nuclear bodies (NBs): a newly Brown,J.W.S. (1997) Clusters of multiple different small nucleolar ., 202 , 211–223. ‘rediscovered’ organelle. Exp. Cell Res RNA genes in plants are expressed as and processed from polycistronic Caffarelli,E., Fatica,A., Prislei,S., De Gregorio,E., Fragapane,P. and 16 ., pre-snoRNAs. EMBO J , 5742–5751. Bozzoni,I. (1996) Processing of the intron-encoded U16 and U18 Leverette,R.D., Andrews,M.T. and Maxwell,E.S. (1992) Mouse U14 snoRNAs: the conserved C and D boxes control both the processing snRNA is processed intron of the cognate hsc70 heat shock pre- , 15 EMBO J ., reaction and the stability of the mature snoRNA. messenger RNA. Cell , 71 , 1215–1221. 1121–1131. Lewis,J.D. and Izaurralde,E. (1997) The role of the cap structure in Carmo-Fonseca,M., Pepperkok,R., Carvalho,M.T. and Lamond,A.I. , 461–469. RNA processing and nuclear export. Eur. J. Biochem ., 247 3756

11 Biogenesis of box C/D snoRNAs Li,H.V. and Fournier,M.J. (1992) U14 function in Saccharomyces Tyc,K. and Steitz,J.A. (1989) U3, U8 and U13 comprise a new class of 8 , ., EMBO J mammalian snRNPs localized in the cell nucleolus. cerevisiae can be provided by large deletion variants of yeast U14 3113–3119. 11 , 683–689. EMBO J and hybrid mouse–yeast U14 RNAs. ., Tycowski,K.T., Smith,C.M., Shu,M.D. and Steitz,J.A. (1996) A small Li,H.V., Zagorski,J. and Fournier,M.J. (1990) Depletion of U14 small nucleolar RNA requirement for site-specific ribose methylation of nuclear RNA (snR128) disrupts production of 18S rRNA in 93 . Xenopus rRNA in Proc. Natl Acad. Sci. USA , , 14480–14485. , 1145–1152. 10 ., Saccharomyces cerevisiae . Mol. Cell. Biol Wang,J., Cao,L.G., Wang,Y.L. and Pederson,T. (1991) Localization of Liang,W.Q. and Fournier,M.J. (1995) U14 base-pairs with 18S rRNA: a Proc. Natl Acad. Sci. pre-messenger RNA at discrete nuclear sites. novel snoRNA interaction required for rRNA processing. ., Genes Dev , 7391–7395. 88 , USA 9 , 2433–2443. Watkins,N.J., Leverette,R.D., Xia,L., Andrews,M.T. and Maxwell,E.S. Liu,J.C. and Maxwell,E.S. (1990) Mouse U14 snRNA is encoded in an (1996) Elements essential for processing intronic U14 snoRNA are Nucleic Acids intron of the mouse cognate hsc70 heat shock gene. located at the termini of the mature snoRNA sequence and include 18 ., Res , 6565–6571. conserved nucleotide boxes C and D. RNA , 2 , 118–133. Long,R.M., Elliott,D.J., Stutz,F., Rosbash,M. and Singer,R.H. (1995) Weighardt,F., Biamonti,G. and Riva,S. (1996) The roles of heterogeneous Spatial consequences of defective processing of specific yeast mRNAs , BioEssays nuclear ribonucleoproteins (hnRNP) in RNA metabolism. , 1071–1078. 1 revealed by fluorescent , hybridization. RNA in situ 18 , 747–756. 383 , 675–676. Maden,T. (1996) Click here for methylation. Nature , Wise,J.A., Tollervey,D., Maloney,D., Swerdlow,H., Dunn,E.J. and Marshallsay,C. and Luhrmann,R. (1994) In vitro nuclear import of Guthrie,C. (1983) Yeast contains small nuclear RNAs encoded by snRNPs: cytosolic factors mediate m3G-cap dependence of U1 and , 743–751. single copy genes. Cell , 35 EMBO J ., 13 , 222–231. U2 snRNP transport. Xia,L., Liu,J.C., Sage,C., Trexler,E.B., Andrews,M.T. and Maxwell,E.S. Matera,A.G. and Ward,D.C. (1993) Nucleoplasmic organization of small (1995) Intronic U14 snoRNAs of Xenopus laevis are located in two nuclear ribonucleoproteins in cultured human cells. J. Cell Biol , ., 121 different parent genes and can be processed from introns during early 715–727. , 4844–4849. 23 ., Nucleic Acids Res oogenesis. Maxwell,E.S. and Fournier,M.J. (1995) The small nucleolar RNAs. Xia,L., Watkins,N.J. and Maxwell,E.S. (1997) Identification of specific Annu. Rev. Biochem , 897–934. ., 35 nucleotide sequences and structural elements required for intronic Mereau,A., Fournier,R., Gregoire,A., Mougin,A., Fabrizio,P., U14 snoRNA processing. , 17–26. RNA , 3 and Luhrmann,R. and Branlant,C. (1997) An in vivo in vitro structure– Zagorski,J., Tollervey,D. and Fournier,M.J. (1988) Characterization of Saccharomyces cerevisiae U3A snoRNP: function analysis of the that specifies both Saccharomyces cerevisiae an SNR gene locus in protein–RNA contacts and base-pair interaction with the pre-ribosomal Mol. Cell. Biol dispensible and essential small nuclear RNAs. , 8 ., , 552–571. 273 ., J. Mol. Biol RNA. 3282–3290. Nicoloso,M., Qu,L.H., Michot,B. and Bachellerie,J.-P. (1996) Intron- Zhang,G., Taneja,K.L., Singer,R.H. and Green,M.R. (1994) Localization encoded, antisense small nucleolar RNAs: the characterization of nine 372 , Nature of pre-mRNA splicing in mammalian nuclei. , 809–812. -ribose novel species points to their direct role as guides for the 2 9 - O Zwieb,C. (1997) The uRNA database. Nucleic Acids Res ., 25 , 102–103. 260 , 178–195. J. Mol. Biol methylation of rRNAs. ., Olmedilla,A., de Dios Alche,J. and Rodriguez-Garcia,M.I. (1997) Received March 31, 1998; revised May 6, 1998; Nucleolar evolution and coiled bodies during meiotic prophase in accepted May 7, 1998 Olea europaea : differential localization of nucleic acids. Eur. J. Cell 74 , 181–189. Biol ., Peculis,B.A. and Mount,S.M. (1996) Ribosomal RNA: small nucleolar Curr. Opin. Cell Biol ., 6 , 1413–1415. RNAs make their mark. Peculis,B.A. and Steitz,J.A. (1994) Sequence and structural elements Xenopus oocytes are evolutionarily critical for U8 snRNP function in conserved. Genes Dev ., 8 , 2241–2255. Petfalski,E., Dandekar,T., Henry,Y. and Tollervey,D. (1998) Processing of the precursor to small nucleolar RNAs and rRNAs requires common components. Mol. Cell. Biol ., 18 , 1181–1189. Raska,I. (1995) Nuclear ultrastructures associated with the RNA synthesis J. Cell Biochem ., 59 , 11–26. and processing. Reddy,R. and Busch,H. (1988) Small nuclear RNAs: RNA sequences, structure, and modifications. In Birnstiel,M.L. (ed.), Structure and Function of Major and Minor Small Nuclear Ribonucleoprotein Particles . Springer-Verlag, New York, NY, pp. 1–37. Reddy,R., Henning,D. and Busch,H. (1979) Nucleotide sequence of 254 nucleolar U3B RNA. J. Biol. Chem ., , 11097–11105. Samarsky,D.A. and Fournier,M.J. (1998) Functional mapping of the U3 small nucleolar RNA from the yeast Saccharomyces cerevisiae Mol. . ., Cell. Biol , 3431–3444. 18 Samarsky,D.A., Balakin,A.G. and Fournier,M.J. (1995) Characterization Saccharomyces cerevisiae : snR34, snR35 of three new snRNAs from and snR36. Nucleic Acids Res ., 23 , 2548–2554. Samarsky,D.A., Schneider,G.S. and Fournier,M.J. (1996) An essential domain in Saccharomyces cerevisiae U14 snoRNA is absent in vertebrates, but conserved in other yeasts. ., 24 , Nucleic Acids Res 2059–2066. Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: A Laboratory Manual . Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Singer,R.H. and Green,M.R. (1997) Compartmentalization of eukaryotic , 291–294. gene expression: causes and effects. Cell , 91 Smith,C.M. and Steitz,J.A. (1997) Sno storm in the nucleolus: new roles for myriad small RNPs. Cell , 89 , 669–672. Terns,M.P., Grimm,C., Lund,E. and Dahlberg,J. (1995) A common , 4860– 14 ., EMBO J maturation pathway for small nucleolar RNAs. 4871. Tollervey,D. and Kiss,T. (1997) Function and synthesis of small nucleolar , 337–342. RNAs. Curr. Opin. Cell Biol ., 9 3757

Related documents